ID: 1161308284_1161308294

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1161308284 1161308294
Species Human (GRCh38) Human (GRCh38)
Location 19:3578956-3578978 19:3578995-3579017
Sequence CCCAGATGGGTGGGGGCCGGCTT CTCCAGCCGAGGGACCCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 131} {0: 1, 1: 0, 2: 1, 3: 21, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!