ID: 1161309319_1161309338

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1161309319 1161309338
Species Human (GRCh38) Human (GRCh38)
Location 19:3585441-3585463 19:3585494-3585516
Sequence CCCGCGGTGTCGCCTTCCCGGGA CGTCTCGGCTGTCGCGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52} {0: 1, 1: 0, 2: 0, 3: 5, 4: 14}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!