ID: 1161319565_1161319574

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1161319565 1161319574
Species Human (GRCh38) Human (GRCh38)
Location 19:3634660-3634682 19:3634699-3634721
Sequence CCCAGCCTGGGCCAGCAGGGGCC TGAGCCCAGACCTCACCTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 27, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!