ID: 1161321379_1161321391

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1161321379 1161321391
Species Human (GRCh38) Human (GRCh38)
Location 19:3643239-3643261 19:3643275-3643297
Sequence CCACCTGTACCGCGGCTGCTCCG GGACCGCTCAGGAATGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 74} {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!