ID: 1161337361_1161337375

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1161337361 1161337375
Species Human (GRCh38) Human (GRCh38)
Location 19:3721776-3721798 19:3721809-3721831
Sequence CCGGCCCTCAGCCCGCTGTGACT CCCTCCCCCAGCCCGGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 222} {0: 1, 1: 0, 2: 5, 3: 66, 4: 566}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!