|
Left Crispr |
Right Crispr |
| Crispr ID |
1161366936 |
1161366940 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
19:3885526-3885548
|
19:3885564-3885586
|
| Sequence |
CCTGGGCAACAGAGCAAGACTCC |
AAGAAGAAGGAGAAGGAGAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8345, 1: 35403, 2: 95445, 3: 137050, 4: 165011} |
{0: 1, 1: 27, 2: 165, 3: 1019, 4: 4990} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|