ID: 1161374801_1161374814

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1161374801 1161374814
Species Human (GRCh38) Human (GRCh38)
Location 19:3933816-3933838 19:3933858-3933880
Sequence CCGAGGTCAGAGTGCAGGGAGGA CGGTGTCCCCAGTGGGAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 55, 4: 713} {0: 1, 1: 0, 2: 3, 3: 20, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!