ID: 1161376129_1161376138

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1161376129 1161376138
Species Human (GRCh38) Human (GRCh38)
Location 19:3939896-3939918 19:3939941-3939963
Sequence CCAGGCCCCTGGTGGACTTGTAC TCCCGTATGAAGAGTGCAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 8, 4: 116} {0: 1, 1: 0, 2: 0, 3: 1, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!