ID: 1161380676_1161380682

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1161380676 1161380682
Species Human (GRCh38) Human (GRCh38)
Location 19:3963594-3963616 19:3963613-3963635
Sequence CCATGCCAGCTGTGTTGCACAGC CAGCCGAGGGGGCCCCCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 163} {0: 1, 1: 0, 2: 2, 3: 21, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!