ID: 1161397304_1161397318

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1161397304 1161397318
Species Human (GRCh38) Human (GRCh38)
Location 19:4051678-4051700 19:4051718-4051740
Sequence CCCACGGCAAGGTCTCCGGGCTG ACAGGGCCGGGGTCACAGAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!