ID: 1161397361_1161397374

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1161397361 1161397374
Species Human (GRCh38) Human (GRCh38)
Location 19:4051902-4051924 19:4051950-4051972
Sequence CCCAGCCTGGGTAATTATAGCCC AACGCCCTGCTGTGACTCAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!