ID: 1161420689_1161420691

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1161420689 1161420691
Species Human (GRCh38) Human (GRCh38)
Location 19:4174685-4174707 19:4174700-4174722
Sequence CCCGTTTGGGGCTGGCGGGCTCT CGGGCTCTGAGCCGTTGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 179} {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!