ID: 1161435097_1161435102

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1161435097 1161435102
Species Human (GRCh38) Human (GRCh38)
Location 19:4258367-4258389 19:4258394-4258416
Sequence CCTGTCGGAGGAGGAGCGGCGGA GCAGCAGGAGGAGGACGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100} {0: 1, 1: 1, 2: 46, 3: 410, 4: 5563}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!