ID: 1161455364_1161455373

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1161455364 1161455373
Species Human (GRCh38) Human (GRCh38)
Location 19:4367156-4367178 19:4367172-4367194
Sequence CCACACGCTGCCTGCAGAGCAGG GAGCAGGGTGGGCCTGCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 281} {0: 1, 1: 0, 2: 3, 3: 65, 4: 569}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!