|
Left Crispr |
Right Crispr |
| Crispr ID |
1161455364 |
1161455379 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
19:4367156-4367178
|
19:4367182-4367204
|
| Sequence |
CCACACGCTGCCTGCAGAGCAGG |
GGCCTGCAGGGGGAGGGGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 4, 3: 29, 4: 281} |
{0: 1, 1: 4, 2: 24, 3: 196, 4: 1830} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|