ID: 1161456107_1161456115

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1161456107 1161456115
Species Human (GRCh38) Human (GRCh38)
Location 19:4370470-4370492 19:4370485-4370507
Sequence CCTCCGCTGACTGAACCTGCATC CCTGCATCAGGGTGGCAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 98} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!