ID: 1161465731_1161465738

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1161465731 1161465738
Species Human (GRCh38) Human (GRCh38)
Location 19:4429255-4429277 19:4429279-4429301
Sequence CCCTCCTCCATCTGTCCCTTCAG CCATGTTCCTGACCTTTCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 81, 4: 777} {0: 1, 1: 0, 2: 0, 3: 17, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!