ID: 1161465731_1161465739

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1161465731 1161465739
Species Human (GRCh38) Human (GRCh38)
Location 19:4429255-4429277 19:4429280-4429302
Sequence CCCTCCTCCATCTGTCCCTTCAG CATGTTCCTGACCTTTCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 81, 4: 777} {0: 1, 1: 0, 2: 1, 3: 30, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!