ID: 1161474344_1161474354

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1161474344 1161474354
Species Human (GRCh38) Human (GRCh38)
Location 19:4475772-4475794 19:4475811-4475833
Sequence CCACCCCATTCATGGTGATGACA GCCCAGTGTCCCCTGGGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 134} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!