ID: 1161474563_1161474573

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1161474563 1161474573
Species Human (GRCh38) Human (GRCh38)
Location 19:4477089-4477111 19:4477134-4477156
Sequence CCTGGTCCTGTTTGAGAACCTGG GCCTCTCCTTTGTTTCGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 200} {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!