ID: 1161476961_1161476966

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1161476961 1161476966
Species Human (GRCh38) Human (GRCh38)
Location 19:4491523-4491545 19:4491550-4491572
Sequence CCGGCCTTCCCATCACTGAGCAT GCCGTTCCCCTTCCAGATGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 687, 4: 16158} {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!