ID: 1161480987_1161480991

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1161480987 1161480991
Species Human (GRCh38) Human (GRCh38)
Location 19:4510571-4510593 19:4510593-4510615
Sequence CCTGGGGCGGCCCCTTGGGTGAA ACGTCGCCACGTCAGTCGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88} {0: 1, 1: 0, 2: 0, 3: 0, 4: 6}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!