ID: 1161487209_1161487220

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1161487209 1161487220
Species Human (GRCh38) Human (GRCh38)
Location 19:4542885-4542907 19:4542915-4542937
Sequence CCCGCTTCCCTCTGCAGAGTGGG CAAACTCCTAACCGGCACCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 334} {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!