ID: 1161489907_1161489913

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1161489907 1161489913
Species Human (GRCh38) Human (GRCh38)
Location 19:4556159-4556181 19:4556184-4556206
Sequence CCTGAGTTGTGTGGGTGGAGGGC GTCTGTTGTGGGCATGGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 192} {0: 1, 1: 1, 2: 0, 3: 22, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!