ID: 1161507008_1161507015

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1161507008 1161507015
Species Human (GRCh38) Human (GRCh38)
Location 19:4649532-4649554 19:4649551-4649573
Sequence CCAGTTGAGGGCGTTAGGTGGGG GGGGAAGGCACAGGGAGTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 7, 3: 71, 4: 611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!