ID: 1161507538_1161507543

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1161507538 1161507543
Species Human (GRCh38) Human (GRCh38)
Location 19:4652025-4652047 19:4652046-4652068
Sequence CCGCAAGGAGGCCCAGAAGATGC GCTCAAGAACCTGGTCAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 217} {0: 1, 1: 0, 2: 1, 3: 14, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!