ID: 1161507538_1161507545

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1161507538 1161507545
Species Human (GRCh38) Human (GRCh38)
Location 19:4652025-4652047 19:4652058-4652080
Sequence CCGCAAGGAGGCCCAGAAGATGC GGTCAAGGTGGCCCTGAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 217} {0: 1, 1: 0, 2: 4, 3: 26, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!