ID: 1161518787_1161518799

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1161518787 1161518799
Species Human (GRCh38) Human (GRCh38)
Location 19:4712050-4712072 19:4712088-4712110
Sequence CCTCCAAACGCCCTGACCAGGAC AGCAAGTGGCCCAAGACTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101} {0: 1, 1: 0, 2: 3, 3: 23, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!