ID: 1161518796_1161518803

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1161518796 1161518803
Species Human (GRCh38) Human (GRCh38)
Location 19:4712079-4712101 19:4712109-4712131
Sequence CCCAACGGGAGCAAGTGGCCCAA GGCGCCACAGGATAAAAAAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 6, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!