ID: 1161518802_1161518805

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1161518802 1161518805
Species Human (GRCh38) Human (GRCh38)
Location 19:4712098-4712120 19:4712115-4712137
Sequence CCAAGACTGTGGGCGCCACAGGA ACAGGATAAAAAAGAGGCAACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 73, 4: 673}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!