ID: 1161521240_1161521246

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1161521240 1161521246
Species Human (GRCh38) Human (GRCh38)
Location 19:4724492-4724514 19:4724529-4724551
Sequence CCATCAATCACGGAAAATTTTTT ATGTCTAAAAGGCAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 499} {0: 1, 1: 0, 2: 2, 3: 29, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!