ID: 1161528061_1161528072

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1161528061 1161528072
Species Human (GRCh38) Human (GRCh38)
Location 19:4769632-4769654 19:4769682-4769704
Sequence CCAAATATCCGGACAGCGCCTCT CTGTTTCAGCACCGGGGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 18} {0: 1, 1: 0, 2: 0, 3: 13, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!