ID: 1161531392_1161531403

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1161531392 1161531403
Species Human (GRCh38) Human (GRCh38)
Location 19:4792120-4792142 19:4792151-4792173
Sequence CCGCCTCCGCAGCCGGCCACCTG GCGGAGCCTGCTGCGCCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 326} {0: 3, 1: 2, 2: 1, 3: 18, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!