ID: 1161570038_1161570043

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1161570038 1161570043
Species Human (GRCh38) Human (GRCh38)
Location 19:5025488-5025510 19:5025509-5025531
Sequence CCATCCACTTCCCACAGCCAGAG AGAGAGCTTTCTAGAAATTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 138, 4: 694} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!