ID: 1161579955_1161579963

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1161579955 1161579963
Species Human (GRCh38) Human (GRCh38)
Location 19:5075266-5075288 19:5075292-5075314
Sequence CCCTGGTGTTGGTTCCGGGGGCC CTGCTTCAGGGAAGTCCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88} {0: 1, 1: 0, 2: 0, 3: 15, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!