ID: 1161579955_1161579968

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1161579955 1161579968
Species Human (GRCh38) Human (GRCh38)
Location 19:5075266-5075288 19:5075318-5075340
Sequence CCCTGGTGTTGGTTCCGGGGGCC AGGGATTGTGTTGCACACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88} {0: 1, 1: 0, 2: 0, 3: 15, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!