ID: 1161613695_1161613709

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1161613695 1161613709
Species Human (GRCh38) Human (GRCh38)
Location 19:5257903-5257925 19:5257938-5257960
Sequence CCTTCCTGCTTGGGTGTGCAGGG CGGAGGCGGTGAGCCCGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 243} {0: 1, 1: 0, 2: 1, 3: 23, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!