ID: 1161642950_1161642959

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1161642950 1161642959
Species Human (GRCh38) Human (GRCh38)
Location 19:5435715-5435737 19:5435759-5435781
Sequence CCCTCCTCACTCTGCTCCAGCCA GTCAGACTTAGCGCTGCCTCGGG
Strand - +
Off-target summary {0: 10, 1: 32, 2: 118, 3: 371, 4: 1327} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!