ID: 1161668613_1161668618

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1161668613 1161668618
Species Human (GRCh38) Human (GRCh38)
Location 19:5591697-5591719 19:5591714-5591736
Sequence CCTGCACAGCAGTACAGTGGCCC TGGCCCCAGGGCTTGGCATCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 219} {0: 1, 1: 0, 2: 2, 3: 33, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!