ID: 1161684064_1161684069

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1161684064 1161684069
Species Human (GRCh38) Human (GRCh38)
Location 19:5694501-5694523 19:5694535-5694557
Sequence CCACGGACTCGGCCTCGCCGCTG GGCCGATTTCCGTAACACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 185} {0: 1, 1: 0, 2: 0, 3: 2, 4: 15}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!