ID: 1161714579_1161714600

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1161714579 1161714600
Species Human (GRCh38) Human (GRCh38)
Location 19:5868122-5868144 19:5868167-5868189
Sequence CCCTCTGGCCCTCAGACACACTG GAGGCTGGGGAGAGGTGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 311} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!