ID: 1161718554_1161718567

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1161718554 1161718567
Species Human (GRCh38) Human (GRCh38)
Location 19:5891154-5891176 19:5891204-5891226
Sequence CCCACCCCCCTTTTTTTTGTCTT GCTTAGAGACCCCCGGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 40, 3: 490, 4: 2963} {0: 1, 1: 0, 2: 0, 3: 6, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!