ID: 1161729115_1161729124

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1161729115 1161729124
Species Human (GRCh38) Human (GRCh38)
Location 19:5948117-5948139 19:5948158-5948180
Sequence CCCCTAGGAAAGGCCAGAAAGCA TCCCTCTAGATGGCTGGGCGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 21, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!