ID: 1161737932_1161737942

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1161737932 1161737942
Species Human (GRCh38) Human (GRCh38)
Location 19:6002920-6002942 19:6002951-6002973
Sequence CCGCTGCGCTCCTTGCAGGGGTG CAGGGACAACACAGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 191} {0: 1, 1: 0, 2: 2, 3: 69, 4: 492}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!