ID: 1161738633_1161738636

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1161738633 1161738636
Species Human (GRCh38) Human (GRCh38)
Location 19:6006997-6007019 19:6007014-6007036
Sequence CCGTGGGTCACTTACTGGGGACC GGGACCGGCCTCAGCACGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 104} {0: 1, 1: 0, 2: 1, 3: 2, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!