ID: 1161740488_1161740494

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1161740488 1161740494
Species Human (GRCh38) Human (GRCh38)
Location 19:6018264-6018286 19:6018283-6018305
Sequence CCGGCCTTCATCTCCTTTTTATG TATGAAATAGTGCTATGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 64, 4: 602} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!