ID: 1161747930_1161747933

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1161747930 1161747933
Species Human (GRCh38) Human (GRCh38)
Location 19:6072934-6072956 19:6072951-6072973
Sequence CCCAGAGGTATTGACAATAGGGT TAGGGTTTGCAGAAGGTTCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 44, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!