ID: 1161752843_1161752851

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1161752843 1161752851
Species Human (GRCh38) Human (GRCh38)
Location 19:6110275-6110297 19:6110310-6110332
Sequence CCGGACGTTTGGGGTGAGCGGCG CCGCCCCCCGGCCCCCGAACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32} {0: 1, 1: 1, 2: 7, 3: 27, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!