ID: 1161761967_1161761973

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1161761967 1161761973
Species Human (GRCh38) Human (GRCh38)
Location 19:6180219-6180241 19:6180252-6180274
Sequence CCATGAAAGATTACATATTCACA GTTAGAACGTGGACATCTTTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 54, 3: 275, 4: 959} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!