ID: 1161768153_1161768157

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1161768153 1161768157
Species Human (GRCh38) Human (GRCh38)
Location 19:6217933-6217955 19:6217948-6217970
Sequence CCAGCTGCTCTCCATACACACCT ACACACCTTGGCTGTGGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 740} {0: 1, 1: 0, 2: 1, 3: 5, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!